Description :
Non Conding Region
Location :
Scaffold_1:72629- 74144
Sequence
1515 bases(100 bases per row)
TTGCTAGCGAAAAACGGGCTCTGCGTTTCTCGTCCGATCTTGGTACGACGTGTTCAAGTTATAAGCGCGTCAATAAGGTCACTACTCCTTCGTACTGTCC
GTAGAGAGCCACACACATAACACAAGCCGTTCGTTAGGTTAGCATGTCTATATAACGGTGAGCTACAGGAGGAGGGACGGGCAGGTAGGCAGGCAGGCAG
GCACCCGTAGGACGGTAAGGCAAGTATCCGGCGGTTGGATGAGGTGGCGTGACTCGGGGGGATCAAACCAAATTGGCGTCTGAGCACTTCCGCCCCTCAA
CCGTCGACCAGTTCCTCTCCTCCATGCAGAGCGAGCGGAACCAAAGAACGCTCCCCATCACTCACTCTGGTCCCGCCGTCTAACGGAGCCGATCCTTTCC
CCCATCAGGTCCCTCAAAATAAAAACAGCGCAATGGAAACATGTATATATCTACATACCTCGCAGCCGCCGTGATTGATGGATGGGAATACAACAAAGCC
GACCCAAGAAATTCCAGGAAAAAAGCTCGCTCGTCGCGCTTTCTTCTCCTTCGCGCCACTTTCGCACGCCACACCGCAATGGGTTCGCTTTTTTTGTTTG
CTTCCTCCTCCTAAATGCGCAGCAGGCCGTATAACGGGACGCGTGGAGACGACAGCGGACGCTCGTGCGCGTAGAGTAAGACCGTAAAGACCGTAAGAAG
CACCGAGCCGAGCCGCTGGTACAACCACCAAAAAGAGCGCGTCTTGCTTGCTTCCCCGCACCAAATCGACAGGTAGGGCGGTAGGTACGCGCGGCGCGCA
CTTTTCAAGCGAGTGGCGCGGCGGGAGGCGGTGGCGGAGGGAGCAAGCGGGAGGGGGAGCGAGCGAGAAGGGGAGAGGCGAGCGGACGCCCGGGCGGAGC
GGTGGTGGACATGAGTGGACGAACGGAACAGGTGGCACGTATAGAAGTATACTGTGACTGTATACGCTGTCTGACCATCATTCAGCTGTATATGGTCGAG
AATAATCTTGAACCTGATTCCTCCAGCTACGTGGTGATCAAAGCCGCATCGCGCAAGATTTGTGGACCCTTCATACAAAAGAAGAAGTGGAGGGCTCAAA
TAATGGCCTCTACGGTGTTCGATCGACACTCCGACATCACGGCGGCATCTCCACCTAACGGTCGTCTTCCCTCTTCTTAAGCTTCTCAAGCATGGTCTTC
ATGCACGTACACTGTAATAGTAGCAGCACCGGACGACTTGTGCTGTTATACCAGCATCGCGTTATGACGAATAAGCCACCCGCTATGTCGTCACACCGCG
TCTTGCTGTGCTAACCAGTCATATCTGCGCATGGCTCATGTTTTTCATCAGGTTCATGGATCCATTACGCATGCATGCATGTCAGCTGCCCGTATCCGAA
CGATCATGTACATCTGTAATACAGATGAGTACTGTACCTTGTCGACTAGGTACTTATTCAGATTTACGGTACTCTGTCTAGTCAGAGCGGCCGCCAAAAT
CACAAGCTCACTCCA