Description :
Non Conding Region
Location :
Scaffold_1:72608- 74646
Sequence
2038 bases(100 bases per row)
ggctaagttagaggcactctgactccacactgcgcgatgtcgagtagctcttccaaatcgttgtaatcgcggcaagcagcgcgcaaaacggaggggatca
tgttcttggcggacctgtagtcaccgggcgattgaccccgtatcagttccacgaacgatggaagaggcattctagtgcgacggacaaactcggacaatac
ctcttggagaggtttgttgaTAGCAAACATGCCGTCTCGCTCGACTCGCTCTGGGGGCGGCAGCTTGAGACCGACGGAGCCTAGAGCGAGATTGATGCGG
TGTAGACGTAGTGCTTCCCACATGACTGCACGCTGGGCGCCAGCTCCGGCGTACCGCCGCGTCGACACGACAGTCGGTGGTGGGCGGATTGTACCTGACT
GACTGAGCGGTTTGGCCGCGTGTTGTGGAGTTGGAGACGGAAGCGAGCCGCTCGAGAGACCGCTCATGGGAGCGGCTTACGGGCAATTGGGCGCCACGAT
CGAGGTGCCATGGGGCGACCTTTGTGGTTGGGAGTCGCCGTGGGGCGAACTCGAAATGCTGGACATGTGTGACGATGATGGGATGCGTGTTCGTGAAACC
TGGCGCGATGATGTTTCGGATGGTGGATACAATTTCGCGGTCGGTAACGGGCAAATCTTGTCCTCACTTGAACGAGAGATGTCGATGCACTGACGTTGAT
AGAGCTTACTAGCAGAAGTATATCCAACTGAAGTGTATTTGGATAGACTGCTTTCTGACCGAAGTGGCGGTAAGCGCGCAGCACTGCGGCCCCTTCATGG
GCGccggtgacgactgtcgttggaaccgcttgagccgtacgtgtagtgacgatcaatagaatcttggacgtcctggggcagccgacgactccaGTTATGG
GTTCGTGAAGCGTAAGCACAGCGACTTGGACTGTCGCCGTAGCACATTCCGCCGAAGAGGTAGTGGAGGCACGGCTCGCGACCCTCAGAATCGCGGGGAA
TTTGACGTCAAACGTACTCCGGCATCACCGGAACCCGTCCCGGTGGGGTCCTGCGCGGTCCTGACGTGCTAGTGCGAGCCGTAGAGTGTTCTGACCCCGA
CGAGGACGGCGGCACTGACGGTCGAGCGGGCTAAACCACTCAGCGACGCTTGCCAGTCGGCCGCGTGGTAATCAACAGCCGCACGGCTTCGCAATAGCTA
CGCCACCACGTTGGCGAGTCGTCCAAAAGGTGCGCCACCGCTCTACCCAGAAAGCTATTCACGTAAAATAGAGTTAGTGTAACACGTTCTGGGATATTGC
TGTCCCGTCCATGACGAAGCGCTTCAGCCGGGAGAATAAACGACGGATGTGCTCAAAGAAAAGCACGTCGCCTAGGGAGGTGAGGCCACTAATGGCAGCT
AGCAAGTCTCCGTATGTCTCACACTGAGGAGACGTCGTCGGCAGCGTGGCCCCGGCCCCGAAATCCGACGCAAAGTTGGCGTTTGTTGATCCGCGACTTA
GTTGCTCCGTCTCAGTCAGCGGCCGGAAATGcatgattgttaagccacggttgccgatgcgggcactgtatatggccatcaagagagcggggttgacttc
gaagcggacgcattcgagctcgcgcagttgcaaaacaaaagacataggtgacgtatacgcgccttccgtagtgctgagtaccttgaacatgcggtgagcc
gcgagctgatgtgcttgtggtgggtaatacccgccttttacccgcgtccacggggccggaaagctcgaactgcgacgatgctgagtagctaggggcggca
tgtcGTCTGGGTTCCCTGCAGGCGGAAGAGTCCACCCAACTCGTGGAGCCGCACTGTTGCTGTGCGTGGCGACATCTTGAAGCCGGTCGTGCAGTGTTGG
AACTGGAAGAGAATCTGTGCGAACCGCCGAGTCTGGCACTGACGAGGCCTGGACCTTGGCGCAGAGCTCGTGCACCAGCTCGAACAAACGGCCGACCTTG
TGCTCGAGCGACACGCTGGAAGTGACGGCTGTGTCGGC