Description :
Non Conding Region
Location :
scaffold_1:72517- 73283
Sequence
766 bases(100 bases per row)
GCGTTGACTTCCGCTTCTCGTGCCAATAGCTGCTGCCTCTTCGGGTCAGCATGGAGGGAGGGGGCAGCAGTAACACTGCCTACTCTTTCTGGCGGTTCGA
CAGCACCAGTGTGTTGGTATCCGATGCTGCTGCGACGAATCCGTGCTGACTGCGAGCTTCTGCGACTCGTTGGAGGGTTTGCTACGGCGCCTTGCGGGTC
TGTTGGAACTTGAGCATCTTCACACTGTTGGACGCGGCTCTGCTGCAGCGAGCCTCTCTCGCTAGCTCTGCGTTCTGCACTGGGCGGATTAGCGGCAATA
GCTGCTCGGAACTGCTCTCTAGGATCCTGTGGTGCTGATCTAGTTGCTGACGCATCAAGAAGAGCTGTTGTTGCAGGTTTCTTGGCTGCTGCTCGTGGGG
TTGCAGTCGAAGGAAAGAGGTTTGCAGGTGGCGCATTCCACCGCCGCTTGGCGACTGTGGCTGGCGCACTGCCAGGACGAGAAGAAGACGATGGAGCTCG
AGGCTTGGAAGTCAGAGCGGGGGGAGGTCTGGCGCTGGTCGCTAGCGGCATCTCTAAGACTTCGACCGCCTAAATTTAAGTTGCTTTTCGGTGGTCGACT
TCAATTTGGGTACTTCAAGATGAACCTATAAAAATATACGGTAATTGAAATGAATTAATTGTTTTAATTTAATATGGCGAACCCTGAATAGGAAAATATA
TTTTTTTCCCATTCGCGAGTTTTCATCCAAGCTGCTAACGCCGTAGAACCCATCCAGCCGCCGCCA