Description :
Non Conding Region
Location :
Scaffold_1:72384- 73357
Sequence
973 bases(100 bases per row)
TCGCCTGCCGCAAGCTCCGTGCCTTCGGAGAGATATTGGAGCACATCGCTAACCAAGACGTCTACTTCACCGTCGCTTCGTTCAAAGAGCACCGCAAGCA
TCCTGCTCACAGTTATGAAGTTCTGGTAGCTTGGGAAGGACTGGAGGAGATTGAGGACTCCTGGGAACCCATGACGACAATGCATGAGGACGTCCCGGTG
AAGCTGCAGGACTATGTACGTACTGCGGATGACTCGAAATTGAGTCAATTCCTATTGCATCTACAATCTACTCGCAGGAGCGGCGGTAACCAGTCCACGA
AGAAGAAGAAAGCAAAGAAACCAGCAGCTGTTTCGAAGGCCATCAAGAATTCTACGCGTCGCGCCAAAACAGGCAGCTCAGCGGCGAAGCAACAGAAGCC
TGCCCGCCGCCTAGCCAAGTGATACATGGTGGTGGCCTGATTCCTAGCAAGGGCAAGGTCGTAGCGTACGAATGCCTGCTTGGGGGCCGTGTAGTGGCGC
CATGGCTACATCTCGTGCCAGCAGGCATATCGCACGCAACGGATGCGACAGCAGCTACAAAACGGACTCTAGCGAGAATCTGGGAACTGGCAGATTGCAT
TTGACTACACTATACTGCATACTCTAGGAAGATTATTGCTTAGCGAAACTAACAGAAACCACTGCGGCCTTTCCCGCAGCGGCAGCATTCAATACAGAAT
CCCATTTACCTCCGATCTCACGCAAGCACAAGGGTCGCAAGACACTACACGACCATTCCAGAGTATCCACGTGGTGAATCTGCGCGTAATGAAGCAGTCC
ACTGGACCCTGAGCAAACGCCACTCGTTTTCCACACGTAAGCGTACGTGTCTGCATCTTGCGCTTCAACGTCGCCTCCTTCCAGAATACAGCCAGAAGTC
TCGTCAAATACGCTTTGTTTTCTGGATTCGAGATCGTCGCCACTCGTACAGTTCCTGTAAAAGAATCAAAGCC