Description :
Non Conding Region
Location :
Scaffold_1:7238- 8498
Sequence
1260 bases(100 bases per row)
ttgctgcttgtgtAGCTTGGTTGGCAGTTTTTTTGCTAGTGTGGTTGTAGTTGTTAGTGTGTTTGAGTGGGTCGAGCTCAATTGAGTTGTGATGGGTAAT
TGTTGTCAGGTCTCAGTCATGATAACGGTGAGAAATAATCTGTGCGGTATTCACAACGGCTCTACCGCAGAATGAACAACAGCTATAGCATACCAATGCA
CATACTGGTGAAAGCTCTTTCTCGACATCTGGTTTCGTTGCCTCCTGGTCCCAAACCGCATGAGCGTGTGGATTCCTCACACGCACGTGTTCCTGcaaaa
tacatgtacgctgGCCAACAAGAGGAATACCGAGAGCTTCTACTACAgtgtacatacatgtacagtacatatAGCGTCTAGCGATATCaagcagtacatg
tagtaggAGCATTAACTGAAAACTCTTTTAACTGTTACCGTCTTCTGTGTCGTTTCCTGAACATGGAAGACATAAACGTAGGTAACTGTTATCTTGTCCG
AAGCACCTGCACTCAGACATGCGACCACCAAGACGTCGCTTCAACATCTGGTTTCGGGGCTTCGGACACTACATGTGCCAACTCCAACAGACACCGCATG
ACCCTGGTAAGACCTTCGCAGCTGCGTTTTCTGCGCATTCTGCCAAAGCATGACAAAAACTAAAATCTTTAGTGTCTACGGCTAAATGTGCATGTAAATG
TCCCTTCACGTATCGATAGATCGACGTTTTCTTGGTGTTTCGTCGTGACTACAGTACATCGAGTGTAGAGATCAGTAGGCAACATGGGAGTCACTGCAGC
CGATGCAGGGCTGCAACTGCCACGTAGAAGAGTACTGAGGTTGATACTGGTCCGACCGtgagatgaagctgctctgaTAGTTGGAAAATCCTCGCAATCT
CGAAAGCCAATAAGCTGACGCTTTTTCATGAAGGCATCCCAGAAACAGATGCATGTACAAGAATGAACAAGTCTGAAGGCCCAATCCAAATTAACTTGTA
CACGGCGTCCCGGATGTCGAGTCCAAACAGCAAAAAAGATCATCGTACAGCTCTTCACCACACGTGTAGCATTCTTTACTCGTTGCCAGCGCTTGGTCCA
AGTACCCAGACTCACGGCCGATGGCGGCAGTGCAGATGGACGTATTCCTAAGCCCTTGAAATACATTACCGGCAGTTGGAACgcaaaaataaaaatacTT
GGGGGAAATTCCAATCAATCAATAAATACATGAGCACATGAGTTACCCCTAGTTTAGTGT