Description :
Non Conding Region
Location :
Scaffold_1:72328- 72395
Sequence
67 bases(100 bases per row)
TGTGGCATACTAGTATGGATGGAGATCATAGAGACTTTTGGCTGAGACTGTAGGAGGAGTTTGTATT