Description :
Non Conding Region
Location :
Scaffold_1:72325- 73167
Sequence
842 bases(100 bases per row)
TTGCGCCGTGTTGTCGTCAATTGATTTGAGAAGCGTTAATGGTTAAGAGGGACGCATCCAATGGATATGAAGGAATAGCTAGTTTAAGTTTACGAAGGTG
GGCTCTCATTAGTAGGAATATTCAGCTAGTGGCTCCACGGAAATCACCCCGATCTGCCTGACAGAGAAGTATAACTCAGTGGTATCATACTCTGTGTTTG
CATCACGTCTATTTTGTGAAATATAAAATTTCACAGGTAAGACTTTACCTACTAATGAGTTAATTACCCCTATGCAGTCGTCCGAACATAGCTACAAATG
AGCGCAATGGCAATCCGCTTGAATCTCCACGTGGTCAAAGTGTCCAAACTTGGCAGTGGCAAATCACCGACGCGTATTTTGGCGTGTCGCATGGGAACCT
GCGAAACATGATATTGCTGTGCACTGGATTCCAGAGGCGACAAATTTTATCCTGGATTCACGACCGCTCATGTCCGACACTGAGGGCGTCTACGCAGAAC
GCAAGTGGGATGTATCCAGGCACTATCCAGGCACGTGGATCTATCCAAGGTGGCTCTGCCAGTGGCTCAAGCGAGCTTCAGAAGCACGGAGTGTGTGGGA
ACGTCATCGTGCAAGGGAGCTCTTTAGTACCAATAGGTAGTAGTAGGTATTACTATTCGCAAGATGGAATTGCTTAAATCGATGCCTGGATGTTCGTTGC
GCACGTCGATGCTGCAACAAGACATCCCACTCTGCGTCGTGTCCGACCATGTCCTGTCCAGCGCCGCTCCGCCCTAGAGACTCGAACCTCTCTGTTTCAT
TTTCAATTTCGACATCAACCATGCTCCACCTCTTCACGGCAA