Description :
Non Conding Region
Location :
Scaffold_1:72269- 72358
Sequence
89 bases(100 bases per row)
ACAACAAAAAATTTGGTGATAATTTCATCAGGTATATTGTTCTTCTCATCTCATTCCGTTGCACATCATGCTGCTAGCAAGATAGCACT