Description :
Non Conding Region
Location :
Scaffold_1:72257- 73047
Sequence
790 bases(100 bases per row)
CCATGTCCTCGGATGTATAGTTATCGGATGCGATGTCACCATCACTCGACCGTGTTGCCTGTCTATGTGAAAAGGCGGTTGATGGCCAGTGCTACGGTAG
TCTCGGACGCCGCACCGGTCGTCGCCGCAGGGGCTTCCTCACTACGCCGGTCGTCGACTGCAGTAGCAAGCTTGCACCGTGTGGTCGTGACGTCGTAGAG
AATAGGACGACGGGCATCGACCTCGCCCGGCAGCTACCAAAGAAGCCAGCCCCGCGAACGTAGCACGCATCATCATGGGCGGAGGCGTGTAATGACCGTC
ACGTTGAACTTGATGCGTGATAACCCAGCGTCCTGGCTCACGAGCGCGATATCAGACGCTGCTTGCGTCGACAAGAAGACGACTACGTAAGCGTCGGGAG
GCCTGTTTCTGAACGGCACCGCAGTGTATCTCGGTGGCGCTGGCTACTTCTAGGTCGCTGCATAAGCGCGCTGGGCAAATGGCGACCGAGACACCGCAGT
GAGCCCGACCTCGAAATGGCGTAATCGCCTTCGCATACCGTCTTGGCGTGTGGCGCTGCCACGTATTCGCAACCGTAGGCTTTTTGTCGCCCTTTTTCTC
CAAAAAAGAACTAAGGCAAATTTCAACTTGGATTTCGAGGATTTCGAGAGGAAGTTACCTACGGTGTAGTGCCTACGGTACTTCGCTGAAAAGAAAGGCC
ACGTCTGCATCTTTGGGTCAACTTGTCTGTCGACCTGGGACGTGACACGACTGACCGACGTAAATGCGAATTGCGTCGACGCAAAAGAGG