Description :
Non Conding Region
Location :
Scaffold_1:72212- 73093
Sequence
881 bases(100 bases per row)
AGGGAGTGCGTAGACACGTAGATCTCCGAGGGCTGTGGAATTTGCAGTCAGGACACTGTGTAAGATATATTTGCAACGATAGCGACAGGTACGGCTATCG
TGCCTTAAGCTtaagagagagagagggatATTTTGCTACTCGTGTGCAGTCCTTCAGTTGCTACAGTTATCCCTGACAGCCGTGGAGTTGGGAACGGAGG
TGTGTCAACGTCTCCTGCAGCATTACTTGGTGTTCCTTGATGACTTGGACGACCTGAGCATCATTACTGGGGAAGTTCTTGTCAGAAATGAGGCGGCGCC
CGATTTCGTCGATGGATAGAAAGGAAGTATCTGCATTGTGTGCCTCTTCCTGTGATTCGGCTGGAAAAAGAGCTTGGTCGGTGCCGCATAAAGCTGCAGG
GTTGTCATCACGTGCAGTTGGCTGCAAAGTTGCTATCGTTTTTGATCGTCGCCTCCCTAGAAACGAAGCTTCTGGAGGCTCCACGGGCGGTGGCAATGGA
GAAAGTTGTCTGCAGACGCAGTAGAGTAGCGTGGCCGCGCTGGTCAGATTTGTTGATGTGTGTTTTCCAATGTTTTTGGATCCAATGCCCACAGTCCAAG
GCTGCAAAATGACGTGTGGAATCAGGATCCGCACGAGCAAAAAATTTATCAAGACGATGTTGAAGCGTGAAACACCATTGCTAGGTTGCGCAGCCAAGTC
CTCACTTCTCCCATTCCCTTTTTGGTCGACCAGGATAGTTCCTTCAAACTCCATTCTCCGAGTAGCGCCGAGAGCATCAAATTCGAGATTTCGTCGTTCC
TCGTTGAATAGCTGGTACTGTTGAAAAGAGGATCAAAGACGCGGTCAGTCTTGAACAACAAGTCGATTAACAGCAGGCGTC