Description :
Non Conding Region
Location :
contig_1:72031- 72230
Sequence
199 bases(100 bases per row)
CGAGATCGAGCGGTTTGAGGAGTCGGCAGGAGGAGGTCAAGATGCAGTTAGAGTAACACGCCCAAGATCTCTCCCGGTTGCGCTGATTCGGGTAATAGGC
AGCATTATAAGCTGCTGATAAACACGCCAAACTCCCATGCATCTCCATCGATGGATGTCTGTCCGTTGATTTTGTCTGTCTTGTCTCTTTTCTCTTCCT