Description :
Non Conding Region
Location :
contig_1:71987- 72186
Sequence
199 bases(100 bases per row)
CGAGATCGAGCGGTTTGAGGAGTCGGCAGGAGGAGGTCAAGATGCAGTTAGAGTAACACGCCCAAGATCTCTCCCGGTCGCGCTGATTCGGGTAATAGGC
AGCATTATAAGCTGCTGATAAACACGCCAAACTCCCATGCATCTCCATCGATGGATGTCTGTCCGTTGATTTTGTCTGTCTTGTCTCTTTTCTCTTCCT