Description :
Non Conding Region
Location :
Scaffold_1:71865- 72323
Sequence
458 bases(100 bases per row)
TGTCATGGTGGTGGTAGGGTGGCGCGTGATTGTTGAGCAGGTTTCCCCCTCCCGTTATGTAGTGTGTACTTCCAAGTTGCCAAGATTCTTGGACGAGACA
ATGCATATACTATCAGGGTACCGTTCATTGCTAGATCGACAGCGAATACGACTGTGTTTGCCGCTCTCTAGTATCCCATTTCTTTGATGAGAGTCTGATA
TCCTTCAGCGTTGGCGTTTAGCGACATGGGAGCAGAGTCGCGTTCCTCGGACCGTCTGTGGTGGGTGATCATCAACGCATGATAATAAGGTGGTTAGTGT
CAGCAGGGAGCGTGGAACACAAGATGGCGCACATACTGCTTCTTTTGAGGCCGCTCCATGTCGAAGAGATCTAAAAGCTGGTTGCGCGCTTCCCTAACGT
GAGCGATCTACCGCCAAACGACCAGTCAGCGAGTTGTCACCACCAAGGTCAGTTCGTT