Description :
Non Conding Region
Location :
Scaffold_1:71567- 72033
Sequence
466 bases(100 bases per row)
CTGCTCTTGCTTCTGCGCCTTGGACCGGCGGAGCGTGCCGCGGCGGTAGTGGCAGCAGCACTCATCGCAGTCGCAGTTCGTTGCACTCGATAATGAAGAA
AGAAGCACCTTCACCTTCACGCCGCTTGCTTTGTAGCTCCTCTATAACGGAAGTGCGAATGCAGTCCTAAATGGAGAGCGCGCGCACACACACGCACTCT
CGCCGTCTTCCGTTTCGTCTTCTTTCCAGGCGCGCGATTACGCTCATGCAACTGAGTCTCTGGCAGAATGATGATTGTGCCCGTCCACATTTTCAGGGGG
CGGGGTTGGTGGGCGGCGTCGTTTCGCGGCAAGTTGAAGTTGATGTTGCACGAAAGTTGCACGATAGCCAATTCCGCGCAGGCTTTGCTACAGAATAATA
AGATGAGCTGACGATGCTGCGGCGGAATGCGACGCGAGCAGAGCAGCGCAAATGCGGAGGCGACGA