Description :
Non Conding Region
Location :
Scaffold_1:714- 2080
Sequence
1366 bases(100 bases per row)
TTGCTTACTTTCGACTGGGGGGCTGGTGACTTGGTGGCGTAGGCAGCGCGAGAATTGAACAATGAGGAGCATCTTCGCACATTTCCAAAAGGGATGAACG
CCTTCGTGCGCGCATCCGGTGCGTCTCCGTAAAGAGCAGACCCAACAGAGAGCGAGCGAACGCGCACCGTCACGAACCACAGGAGAATGGATACATAGCA
TTATCACATAGTAACACGAGCGTCCGCGTAAAAGCAGTGGACGCGCATATGTTGCATGGCTCTTTGACGGTGGGCGCCTTTGCGCTCGGGACCATTTCTG
AGTGTTATAGTCAGTTCAGAATGGGTACGGCAAGACCAGATGGCTGGAAGAGTCGGACTAAACCTCTTTATATGCGGTTTTACCTTTTTAAAGTGAATAC
GAGAGCTCTTTTTGTGGGCCAGTAGATACTAATACCAGTAACGTCAGATACCGGATTACTGGAGCTCTTGGAGCTGTCGAATCGTGCTCAAACATCTTCA
AGCTACAGAAAAAAACATCAATTAATTGGATGAAGCTATCGATTACTGATAAAGGCAGACAATATATACGATAATTACTATTCTAGTAAATTTTCCCAAA
CGGGCGACTCGATTTAACAAATTAGCATATATGATTGAAATAAATTGTTTCCATTCAGTGGTTCCATGGCGAAGACGAAACAAATGTGTGTGCAACTTTT
ATAACAATGGACAAAAAAATAACATCGCTTTCAACATATCGCGCAACTCGAGCGGCTTAATCACTTCTTGCGAATAGATTTAAGATGTGCCGCCCTTTGG
GATACTCGAGCATGTTTGAGCGTCATAGGTGTTGCTAAGCCGCACTGCTTTGACTACGGCAATTGCAGCAAAGGCAATGCTGAGTTTGCATTATTATTTG
GCCGTACCCGCTAACGCATGCAAAGACAGATGCCCAGATTGGCAAGCTTGAGCATATTATCGATAAGCTTGAACACAAACATAAGATGCTCGCGGAAGGG
TTGCTAGTGCGTAATAACCCTTTCACGAGTATTTTGGTATGTATATGAGTACCACTCTTTGACCACAATAATGCTGGTGGTTTCTTTTCGTTTCCTCCAG
TGAGATTTCCATGGTTTCTCAACAATTGCAGTTTTAGTCTAAGCACTATTTCAGGAAAACTCTAGTTTTGTTAAGCAATGTTCTAACCGCAATCAATTAT
ATAATTTTTTGACTTTAACATTGCAACAATGCAAAACAGACAAGAGGGATACGCCTTGTTCTATAAGAGATACACAAGAAACTGCACAACTACATCGCAA
CCGCACGCCACTCGAAAAGACTTCTCATCAATATTTGTACATGTCTGTCTGCGATTGGAGCGTTTC