Description :
Non Conding Region
Location :
Scaffold_1:71344- 72051
Sequence
707 bases(100 bases per row)
tcccctctttaatccgataagtctctgccacaccaaaatcaaacaacttaacgttgcgttaaagttgctgaaggatgcgctcgtgcgaccttcggacgac
atgttcggtccgcgacggttgcgatgatgcgtctccgttgaggctcgggcttcacggcgaatgtggcttttgtaatagagagaagccagcaagagccgag
cctgaagctccggaagagaagcgagcaaaagccccgagccacgtgaagacccagcagcccccacgtgttcgcgtatcgtttggctgtaaattacgactgg
gagctccgtcttcttgagcggggagggacacgcagcaacagtcagagcatcagcatcttttggcaccatgggcagcgccagtagtaaagccggcgacgta
aaccctaagaacttgggcgcagatccaaacgaccctaacgcattcccgttgcaccaccacccgtactacaaccaggcgcagtcgcagcaacaaggacgca
gctttaacagtgatgggaaacttccgcactttgccggacaacacaacgccacggaggctatggaagtggacccacccactgagtcctcgtccgatgtgtc
ttatgcagaaggagagataccagtgacagcacaattggacgtgaaagaaggcgggaacagcaaggggaacaacgcacagactgcggatgtcactgtacca
ccaggag