Description :
Non Conding Region
Location :
Scaffold_1:71249- 71475
Sequence
226 bases(100 bases per row)
TTCTTTGAATTTGCTTCTTGAAGAAGGATTCCTGTAAAGGTCAAAAACACCAAAACGCTTCCCATTGGTAGAAATTTATCTGTAAATTTTCTCATTGGAT
AAAAATATGCCTCGCTTCTCAATCTTTTTTGTCGTACATCACTTTGGGTGATGAGTGAGCAGCTCACTTGCAACAACTGGTAGCTGCTCACTTTTCAAGC
TGCCGCCGAGCCCCTCAAGACGAAGA