Description :
Non Conding Region
Location :
Scaffold_1:71194- 71979
Sequence
785 bases(100 bases per row)
ATCTGTGGACAATAACATATTGTGATACGACCTCTTATTGCAATAAATTATTGTTCTTGAAACGTTGCACTGGGACACAATGTTATTGGCGTCAGCATGG
GCTACGCATCCCAGGTGCATGTGCCATGCGCTGTGCTCGAGCGTGCTTCGGTCTCCGACATGACGTGCGTTCGCCTTCCTGCTGTGTTATCTCCCCATTC
TGACgTCTCTTCTGTATGCACCAGCTACGCTGCGTGTCCGCGCTGTGCGACTTCACTGGCCGCCGCGCTGCAGCACCTACCACTGGATCGCATTGGTGTC
TCGTGTCCGTCGTgTGGGGTcgCCATGCCgaGGGAAaGCGTCGCGTTCAAGTACCGACTCAAGGTGCAGCTCCTATTCGACGACGCTGTACGCGTCGCTA
TGCTCTTTAACGAGGCAGCAGAGGCGCTGCTCGGCGTTTCTGCGTCtCGTTTTCGTCaGGTTCGAAaGCCTAAATTCTCGTCTGCGTTGTCTGGGGGATC
TCACAACCTGTGCAGCTACTCCAGCAGCACCCAATGCTGCCTGCTCTGCTGGAAGACCTCCTCCGCGGCCTCCGTGTGTCGTTCACATACCTGCCAGCAC
AGAACCGCCCGCAGTCCTCCATGTTCCAGAAGGACCTCAAGGTGCTGAACATGCAGCCGCTAGCGCGCATTCTACTGCCCAAGCCACCGATCGAACTCGC
TCTTCTGCAGCTCACACGAACCAACACCACATAGACAACCATCGACACAAGCAAACAGAATAAATTCTAGTACGAGGGGTCTCTC