Description :
Non Conding Region
Location :
Scaffold_1:71100- 72154
Sequence
1054 bases(100 bases per row)
TAGCCAAAGAAGTCAAGGCAACTATGAACTTCTGATAGGTTTTCGCCCTCAGGACAATGCAGCCAGCATCAAGATTATGGATCTTGCCACGATACACCCC
CACCATTCATGCCTACATGAAATCGCACTTGCAAGAAAACACTCAGCAATATCGAAAGAATTTATCAAATCTTGATGTTACTGTGGTTCCTTCCTACCTC
CTCCTCTTTGTCTTCTCGCTGCATGGCTGGACCACCGGAACATGAAGTTACCCCACGGCTTCCGTCCTCGCTGGCCCTCATGCAACAATGGGACTCTATC
TGTGCAAACCTCGTCTGCAGGTTCACGCTCGCCCTGCTACTGGGTTCCGCGCCTTGATTTTTCTTGTGCTTTTGGTTGATTATCTTGTACAAATACTGAT
GGCGCCGGCGGTGCGTATTGGCGGTGAAAAGACTCGACAAAGGGAGTGTGGCTCGCTGGTTCGCTAACGTTGGGCCTTCTTCATTGTCGATTAGTTACAC
CAAAACACATGCAGATAATACGTTACTGTCGCACCGCATCCCCTCCGCTGTTCTGGCCTGTGCTCAGCTTCGCCTTGCAGACAAGATCAAACTGATGCCG
TGCTCTTCAGCTTCTCATGCTCGTTTGAGTACACGCCGCATCAGCTAGTTGTTCTTTCTCCACATTCCCTTCATCTACGAAGTTCAAGCAAGAACGTCAA
TTTGAGCAACCAAATCGGAGACCTACTTACTTCGGTTCACAACTTTTATATAGAGACGTGAAGACTTACCAAGTTTGCGACTTGTTCAGGGGCATCGCGG
AGTCTTGTTGCCGTCGACGGAGTCGAGCTGACATCGCCCGTTGGGCCATAGTAAGGACTGCTCTGGCCTTTGGCCGGATACCCGCGCTGAGACCTACTTG
GCTGCTGGACCTCCTCAGCAGCAACCTTAGCACCCAGATCACTGGCGGAATTGGACTGGAAATCAGCAAGATTTTGTCCTCGACCGCTTCGACCAGGAGG
GCTTTCGCTGTTATTGTCGCCCCGTCGATTAGGGCTCTGCGAGCCTCCGTGGCT