Description :
Non Conding Region
Location :
Scaffold_1:70901- 72709
Sequence
1808 bases(100 bases per row)
ATGCTGGGGTCTCCAGGGCCGAGCAGCCGCCGCACGTCGAATGCCACGTGGCTGGAGCTGGCCCCCTCGAATTGGTGACTGAGAGGCAAAAGCTGAAATG
ACGGTAATAAAAAACGGGATAAATTATCCCTGGACAATACCTGTCGCCAGACCTGAATAATACCTGTTTTGCACAACCTGGGCTAGTAGCTTGCCGAACC
TCAAAATATATTATCCCACCCAGTGATTCTGTTGTGTCGCTTCCAAAGGAAATGTAGAAGTGATATGTATTGAGCAGTTCCTTAGTTCGCACTAGCTGCT
CTTGTCCTATGCATGCTCTTGGAGGTGACCACTCTGGTGGCACAAACCGTCCGTACTTGCTGCGTCTGCATAACAGTCCATACTTCATCAGCTGAGCAAC
CGTCCTTACTTGCTGCAGCTGTTCATCTTCTGCAGAGTGTTGGTGTTGCTGGGCTAGACCCCAGCAACGGCTACACAGTGTAGCACCAGCTACAACAGAT
TCGTATGTCCCACCCAAGACATTATCATCGTCCTGGTCGAATGCCGTAACAAAACCAGGTGAAAATTATGATCGAATGCCTTGATAGCTGCGCTTCGTAA
CAAAACCAGGTGGTTTTGTCGGATCGGCTTTTGTCTTGGCCCCAGTATGGTCGGGTAGAATCGTGTGAGCCATTGATTGACGAGCCCAGAACCAGAATCC
TCCGGCACACATCACACTGAAGACGACCGAGCCAACAAGATGGCGCCGAAAAAGGGGAAGAAGAACGCCAAAAAGGCCGCGGCCTCCGCCTCGGACGACC
TCGATGACCTGCTGAACGAGTTCGCGCCCAACGAGGGCGCCAAGCCGCAGCAGGAGCAGCAGCAGGAGGAGGCGAGCGACGACAAGACGGAGGACAAGCC
GTCGGACGTGGACGCCGCCGCCGCCGCGTACCTGGCGTCTCTGGGCGTGGCCCCCGCCGCTGGAGGCGAGAAGAAGGACGACAAAAAGAAGAAGAAAAAG
GGCAAGAAGAAACCCAATGCCGACGCCAAGAAGGACGACGAGAAGAAGCCCATGTCGGCGGCGGCCAAGGCGCTGATGGAGCGCCAGGCCGCCCTCAAGG
CCGAGCAGGAGCGCCTCGAGCAGGAGCGTCTGGAGCAGGAGCGCATCGCCCAGGAGGAGGAGGCCAAGCGCCTCGCGGAGCTCGAGCGCGAGGAGGAGAT
CCGCCGCAAGAAGAAGGAGGCCCGCGCCGCCAAGATCGAGCGCCAGAAGAAGGAGGGCACGTACATGACCAAGGCCCAGAAGCAGAAGGCGGCCAAGGCC
CAGGCGGCCCTCGAGGCCATGCAGCAGGCCGGAATCGTGCCCACCGCTGCTGGCGAGAAGAAGAAGGTCGTGTACTCGGACAACAAGAAGAAGAACAAGA
AGAGCAACAACAAGAAGGAGGAGGAGCCCAAGAAGGAAGAGGTCAAGAAGGTCGAGCCGAAGAAGGTCGTGAAGCAGGAGGAGGAAGAGGAAGTGGACGA
CTGGGAGCAGGCGGAGGACGCCGCCCAGGCCCAGGAGGAGGACGAGGCCCCCGACGCGTGGGATGACGAGGACTGGGAGACCAGCGACGTCGTGGCCTCG
CTGGAGGACAAGCTGCAGGAGGTGAAGGAGGAGGCGTCTGCCGAGGAGAGCGACAGCGACGGAGACGAGGACCTTCTGCTGCTCGAGCAGAAGAAGGAGC
AGGAGCGTCTGCGCCAGCAGGGTATTGCGCTCAAGAAGCGTCAGGAGGAGCAGGCTGAGCAGATGCGCCTGGAGGCGGAGGAGGAGCGTCAGCGTTCCAA
GGCCAAGA