Description :
Non Conding Region
Location :
Scaffold_1:70747- 70879
Sequence
132 bases(100 bases per row)
GGTTTCCAAGTGAAACCGACAGATTATCCGGATATCACGCTTAGATGGATTTCAAATATCCGTGATAGCTACCAGTAATGTCATTGTTAATTCAACAATT
ATATTATAGTGTTCATAGTTTGCCGAAACTAC