Description :
Non Conding Region
Location :
Scaffold_1:70546- 70910
Sequence
364 bases(100 bases per row)
TTGTTGCGTTGGTCTTCTAAACTTAACTAAGAAGCACTAGCGGAGTCCGCAACAGGGCGGAGCCTGCGCACCATCGATTGGCGGGGAACGCCTCGAAGCC
GATTCGTTCAAATACGTTTCGTAAAAACAGATTGATTGGCTTAAAGTCGGAGGCTCTATATCTTCACGTTTTGTCAGTAAAAAGTCAGATTGACGATAAA
ACATCGTTGTGCGTAAATACGTTTTCATGTGGTACACCTCACACAACTGTATCGTGGGTTTTCTGTTTTTGTGTGCGTTTTCTTTTGGGGAAAACGCCCA
TCCGAACTCCATACATTAGACCCTAGGAAAAGCAGCagccggcagcagccacgcaccgccgcca