Description :
Non Conding Region
Location :
Scaffold_1:70442- 71606
Sequence
1164 bases(100 bases per row)
GGCTTATTGATTCCCACTGCAGTTTTTAGCCTATGAAAATGGTGTATTGAGTACAATCATTTGCGGACACGATGTCGAACTCAGGCAAGGCGACTACTTG
GCGGCATTTCAGCTCTTCACGATGCCAATACTTGCCTCCATTGTTGTACTTGTGTGCATCTGGGTTCACTGGTTGCATTTCCCTTCTTCTTGCCATCATC
GTGGCGCGTTAGTATGATGTCCACAAAAGTTGCTGTTGCAGGTGGATAGTGTGATGCGAGCAGGAGCCACACCACACTTGACAGTTCATCATTGCAAGTA
CATGATGCGACTTGCACCAGATCCAACCAGAATTTAGCTGGCACCTCCACCTTGGAACCACCGGTAAGTACACGCTGCGAGCCGCATGTGACGGAGCGTG
CCTGTTCCACTCGTGGTGGTCACAGAGCCTATGCATGAATGTTCAGGTACAGTCTCCCTGGTATTCTCTGAAGCTACGCCATCGCTGTCGAAGGCAGTCC
AGCTTGGAACACCAACGTCTCGAGCCCTGCTACACGGTTGTTGAACACCTAGCACCGCTAGGCTAGCCCATGACAGTGTCTCGTTGGTATCTGTAATGCC
TTGGAGTATCGTCTTGAGCTCACGGATGTTGAAGCGAACTGTGAAATTGATTGGATAATAAAATGTTAATGCTTCAGGATTGGACGAAAAGAATGATGGG
TAATGCCCGAATCGTTGGCATGTGCACCGCCGCAAAGCGAGCTGCGGGGAGGGATGACCCGTCCGAAGTGGCGTCTATGCAGATTCCATACAACTCGCCA
GTGTTTCCGCTCTTCCCATCGCCTCGGCAAAGGCACACCCGAGAGACCGTCGTCATGGTACTCAAGTGCCGCGTCTATCTTATACTACAAGCGCATTCCG
TCCTCGATGGTATCACCGAGACTTCCTCTGGGAAGCCTTCATCCATCATCTCGCAGGCGCCCCGATATGAGTGCCGCCCAGTCAATTAATGCACTGCACA
TTGTGGATGATTTGACCCAATCGGATGGGTGACGTCAGGAGGGGGATTTCGTACTTTGCAGGACACCCGCGCGGTTTTTGCGGCGGACGCTGGTCCAAGC
AGCGTCCGAGCCGTCCACTCCTCAATCCTCCAAGCAGAAAGGAAGCGCTTCCGTACTCTCGAGA