Description :
Non Conding Region
Location :
scaffold_1:70320- 70713
Sequence
393 bases(100 bases per row)
ACGCAGTGTCAGCAGCGTCAATCAAGTGCAACGATAAAGCATCAATACTGACATGTCAAGCTCTTGGTTCTGTACGAAATAACAGTTCTAACGTTGTTTT
ACGGGCGCTGTTGCTGCATCTACCAGCATGGACAGTTTGCGGAAGTTCTGTTTGCGTTTTGAACCAGCGAAAGTCGTGCGAACATGCCAGCCACGGTAGA
TAGCCTGAATTCGTAACGCTGCTGCATCGTGCCGCAAGTTGCGCACTGCGGATTGGGCATAGGATCGGACCTCCGGTCGATTTGATGGCGCTCGAATCAA
CCGCATCAGTGCACCCAACACCCCACTCTCCACGAGCCTCGAGCGTGCTACGTGCAGCTCGGACACAGCTGCAAGTGCTCGAGTGGCCTCAAT