Description :
Non Conding Region
Location :
Scaffold_1:70222- 70392
Sequence
170 bases(100 bases per row)
tcgcgaataaaactgaagtggcgttgtaaatgagcagttttgtggtgtatacaaccggataaagtatactgaaatgaacgtaacgattcatttctaacga
agataaatgatacaaattatccggataaaggtatacgacacactaatgacgactggcattccgaaagcca