Description :
Non Conding Region
Location :
Scaffold_1:70173- 70985
Sequence
812 bases(100 bases per row)
tatgagctggattgctgccggataacgccgctgaccgctgaatagcgttgttcagattcacagaggagatacaatctggccagccgagctcgtttaggta
caccgcagcaggtatgttttgcggaagtgagcttcgagccctgatgaggcacattgcgccgaacacgggacaaataaaacgatgaccggaccgatttagc
aacatgagcgtcggatcaccacgttgatttgtcttcgaaccaatcagtctgatgtgcaccgatgttgctgcctccgggcttagcgtcggtcttccattgc
cgtcacgaatggtgatatcttcagcccttaaggcaagccacgcaaaagtccttcggtttgacgacgcgatctccgagcgacgtaacaagaagaagaaggc
catacataggacccccaaagagctaggtctgaaggtcgattcaaccgaagagacgagaagcaaagctcgagctggtgaagcgaaacgggcgccttgtgtc
gaacgggccggtcgacgcgctcgatgaccttcaagagcatgcgaatctgtggatgaccacacggaaaatccgcaccagcggcagcgaaaaaatggcgaat
tccggacagcgtggctgagattgttgtgctccgaacggggtgccctgagccgtatccagagcgaaaaccagcaggatgaagtccgtgatatgttgAagtt
tcacgtcatgtgatactcggccaaaagttggtgatagtccacgacgtgagcaccagtcgaaccatttgcgtAAAGCCTTGCGGTACTGATCGAAAGTTGT
TACAGCGACTGA