Description :
Non Conding Region
Location :
scaffold_1:70041- 70160
Sequence
119 bases(100 bases per row)
GTGATAAGCCGGGTGCGCGACACAATGGCCGCCGCCCAAGATAAACAAAAGGAGTACTCTGACCGACATGGAAGAGGAACTTAAACGTGTTCAAAGTGGG
CGAGTTAGTACTAGGAACC