Description :
Non Conding Region
Location :
Scaffold_1:70039- 70060
Sequence
21 bases(100 bases per row)
TGCCTACTAAAGTGTATTGTC