Description :
Non Conding Region
Location :
Scaffold_1:69822- 70435
Sequence
613 bases(100 bases per row)
GCGTTGGCGAGGAGGTGTATGTTAGGGATATTTGCAAGATGCAGCATTTTGTATGAAGGTCAGTCTGAGGCGTCCATCCGTACCATTCGGTTCTACTGGT
AGACGTCCTTCTGGAGTTGGGCTCGCTGGAACTGTTTCCCGAATCTCAGACGATTTCACACTCGACTTTGGAGCCCCAAGTGGAGGTTTCGATCGCGATG
TGCTGCCATGAGAACCAGTCGACTTTTGCTTGGGTTGCCCGGCTGGAAGTAATGCTGATCCTCCAGTATGCAAGCTATTGTCTTCCTGTTCGTGAGCAGC
TACAGTTGACTGCAGCCATTTCGTGTGGAGGTCACTGATGGAGCTCAGCTGTCAACAAAAAATAAAGCGAAGGAGTTCATGAGTGTGTGGGGGCGTTGAA
GTAGGAGCAGTTTTACTTGGAAATCGACGAGCAGACCTTTTTCTTGTAGCAGAGACAGACTTCGGTGCCCCCAGAATTCATGTTAAGGTCTGCGAGATGC
CCATCTGGGGTTTTGTCCACCTTCATGAAGCTGGTTTACAGCGGAAAACAAACGCACAAAAGGGTCAATTGCGGTTTTCATAGTAATAACAATGATAGGA
ATACCGATCGACT