Description :
Non Conding Region
Location :
Scaffold_1:69604- 71661
Sequence
2057 bases(100 bases per row)
TCGACTTGAACTTGACTTTGCGTTCACGTGAGCTTGAGACGGACGGGACCGATTGGGATGAGTCGGTTGTGCTTGAGATGGCAAATTGGATAATGAACTG
GACTCCGGTGGTGACATCGACGACGGTGGTGCATGTAATGGACATCACACATGGTTGTGGAACCTTTCGAACATGATGAACACTACAATCCCCAATGCAT
CGAGTCCCACGTAGCAGCATGATATAGGGGGGATCTACTCGAGTAGCTTTACTGTGAACgcaacaaacagcagaacATGGTGTAAGCCAAGGATCAACCT
TCGAGAGCTGTACCCTGTTAACGAGTTCGACAGCCATACTCTACCAAAGCCAAACCAAAGCCTCACCTAACCAGCCCGCCAACAGAGCAACAAGCGATGA
AAGACGGGGCAACGCTGCTCCAACCGCTGGCCCCGTTGCGTGTCACGACAACGATGCCCTCTGCTGGAAGTTCGCAAGCAAGCAAAAAGCTAGAgttcat
tttttttattattattgtGGGTCGAATGTGTACATTGATTATCCTATGGGGTCACAGATCTGGCAAAAATTGCTGATGTAATTGACGCATTGAGCTGACC
GGGAAGCACGTAAAATTAGTCTGCGGAAGGCGTGGCGCCTCACGTGTAGCACATCTCAGATGTTCCTGGGTGGTGGGCAAAGACGATCCGCGTGATGCGC
GTCAACGAATTTGGTACCAAATGCCCACGAATTTGAGAGCGCAACATTGCCATCATATCGACATGGTGGTAACTCGTGATTTACTTGAAGTTTAGGCCCG
TTGGTCGCTGTCAGTGTTGACACTATTGTACATTTGCTGGCCATTCTAGAATTTACGGTCCACAATTCACGCAAGCACTGCACACCACTTCAATGCGTGC
GGGGCTTGCCCACTTCAAGAAGTCCTGTCCGTGACCAGGGCAGATGATACCTTCGTAACCCGCCGATAATCGCTTACCTTGTTTGAGTAAGTTCAATCCT
GATAAGACTGCGTACCTTGCACTGTAAGTTCTCTGCATACATGCATTGCTTCAAAAGTAATAGCTCGCCCACTTGAACCTTCAGCATCGAGAACGAAACC
TCGTTGATAATTCGTTGATGTGCGCGCAAGCTAATCTTTTCGGTGATGTTGAATACCCGCCGAATACATCTCCATCAATGCACGTAGGTTTGTAGACTGC
GATTCAAGCTTTTATTTAACAATTGGTTGACTTCAACTGCAACGTTGAAGCGCTGAACTGGTAATGATAGTGAAATGGCTGCACCCGATGTCTATGCTCT
TGCCCGAAAAGCGCCCATCGGCTGTCATCAATGTTGTGTGTGCATTTCAGTCATTGCTGTGTTAACCAGGGATTAGATTGGATTTGTCACCGAGTTTACC
TAGGGATAACTGCTGTATATGAACCGTTAATCACCGGCAACAGCAAAATAGCGATGTAGATAGGGAAGAATAAAGTGATCAATGTGAGTGCAGGAACAAT
AGGAATTTACATGTAAACACAAAAAGCGGTCCTAGTGATACTGGTGTCACACAAGTTCACCGGTTCACAGCCATCCCTCTCCATTTTGGAGAGCATCAGT
GCGggttgatggagctgcttgtTGTGCAAATCACACCTCGCAAGGGCACCATCACCCGATCGATACAAAAATCATCGCCTCCAGTGcatgttgatgcaga
tggCGGTCAGAACGGCGCCTGGCATCAGGGACTTCAAGTTAGAATGATAACCAAACTCAATAGCAATCAATAGTGGTGTGATGGTAACTTCCAACTTCAA
AATCGTTTGATCTGCGCTTGCTCTTCCCATCTATACTGTACTCTGCCAGTATCTCTAATACGCTGCCACACCGTGATGTGTCTTCGTGCCTTTTAGCAGA
TCAACTGAGACCTCTCTCAGGGAATCTCTGCTTGCGGACCGACAAACTGTCAGGTATGTTGCTGTCCACAAGTTGAATCAGGCATGCTTGCATACCGACA
GTCcaagcaacttcaacttgacaCAGCACGAATGTCAATCAACTCAAATGAGTGGAT