Description :
Non Conding Region
Location :
Scaffold_1:69476- 70105
Sequence
629 bases(100 bases per row)
ACCTCAACCCGGCGGCTCGGACGACGTGCCCTACTCGGACGCGCCGACGTGCTGCCTGTGCGAGCACCACACATGCAAGCAGCAAGTCATGCACGACGTG
CGCCACATCTTTCGTGCGTTGGCCGCCGAGCTTGGCAAGCTCTCGGCGCTCGGTATCGAAGTATTTGTCGTCAACCAGAGCCCCGAGTATCCGCAGATGG
CGCCCGACACGTGCGGGAATCGCGTCCAGCTACCGCCGCCGATGAGCCGCGCGACGTACCGGAAAGAAAAGGCGCGGCTCCTCGACCTGCTGCATACCGT
TGTGAAAGCTGCGAACGCGACGGGGCACCCACCATGTATCTTGGCAAATACCTGAACCCCTCCACGTCCCGTACTCACTTGACGATTGTGGATCAAGTTG
TCGCAGCCGCCAAGGCTTCGTCATAGACCGCTACTAGTGCTACTCCTAACTCGATCGTTTTACAAGGGACAAGTTGTGTGAGCTTGGGACCTGCGACTTG
CGATCTTTTTCTGAATTTGAAAGTTTAAAAAATAGAACCGCGCGGGGATTGGCTATAAAGGGCAGCATTATACGCCATGTGATTGGCTAAAAAGCTGTGA
CGTATGGCACGCGATTGGTGGAATAGACG