Description :
Non Conding Region
Location :
Scaffold_1:69450- 69511
Sequence
61 bases(100 bases per row)
GACCAACTCGTTTATTCGTAATCGATTCTATCAATATATATCTACATATATATATATATAC