Description :
Non Conding Region
Location :
Scaffold_1:69435- 69996
Sequence
561 bases(100 bases per row)
AACATAACGCGCGCTCGCTTTGAGCCCGAAATTAAAAAAATTCGGGGCGCTTGTGAGAATCGATTTCCATGGTCAAACAGTCGCATGGGGGCAAACCTCG
TGAGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNggcaaacctcgtgagtcgattaaacggaggccacggtgctggcctttttggctcgatcctactaag
gacgagttaaatgccccccttgttgaaggtcaacgctgcggccttcttcctggagagtgtt