Description :
Non Conding Region
Location :
Scaffold_1:69428- 70153
Sequence
725 bases(100 bases per row)
GACTCAGCTTAAGCTGGTGTGGATCGAAGAAGGCTGGAGACCTAGCATGGTCGTTTGCGGTGCTTGCCAAAAGGGTCTTCGCTCACGCACAGCTTTGTTT
GTTGCCTAGCGTCAAAGGAACAAGCACATTAAACGATGGCAATAGCTTCCTGTCTTATCACTTTTTGTCTGTTATCgcgtcttctgcttgaagCTAACGT
GCAcctactacgtagtactagTAGTTGAGACTCACCTCAGCAATAATTTACGCAAGAAGGCGAGGTTCTGATAGCTCCAGCTTGTTGATGCTGCGGTGTT
ACTCAGCTCAACACCCTCAGCTTGAACACCGACGAAGCTTTCTGCTATCTTCCAAGTCCTGTAAGCTGCTAGTACGTAGCGTCTGTAGCGTCACGCGAGA
CCTGTAGACACGATGGCAATCACGACAGAGAATCGAAGCACAGGAACGAGACCGAACGGCCCCTCCCGACAACAAGAGCGATAGACCTGTGGATGAAGGT
GATGGTATTTGTGACTCCCCCAGCTTCCCTCTGCGTCCGTTCGTCCAACGAGCGAGCGAACAGAGTGAGGAGGGGAAGCTGTTACGAAAGACACCCCTGC
CGTGCCCTGCAGGTCAGCCCCCTGCTGATCTTCCTCTACAGCGGACCTATCACCTGCCCCCAACGCTGAAAAAGCTTAAGAAGACCGAGCTTTATTATGC
GCCGCACTTGCACGTTGCCACACCC