Description :
Non Conding Region
Location :
Scaffold_1:69374- 69770
Sequence
396 bases(100 bases per row)
GCCGTCGTGGCTGTGTTGCTTCTGGCGCCGATGAGGACGTCGCTCGATGTCTCGACTTTTGGATAGCTATATTTGTATATAAAGTTTCAAGTTGATACTG
TGAAGTGCAATGAGCCACTTTGATTTGTGCTCCGGCAAGGAAATATCTCTTACCATTCCTGCGGAACAGCGTCCAAGGTCCGACGACAGAGGCAACGGGC
CCGCCTTTATGCGCTTCTTCTCCGTGACAAGCACCGACCGTGGACGCTGTCGTCCTCCGCGCCCGGTGCGTCGTCGCCGTCACGGCCTTGCTTCGTATCG
CGCTCGCTCGTGGCGCCACGTCACGGTTTACACTATTTCAGACCAACTTGAGATAAAAATACTGTGGTGGGTGTTTCCCGTTTAAATTCGGCATCT