Description :
Non Conding Region
Location :
Scaffold_1:68885- 69143
Sequence
258 bases(100 bases per row)
actttaccaccaacagcagcgactgtcaccccgtcaagtgagacgccagtaccaactgcccctcaaccttccgacattcccgttgagacacagtcaccaa
gtgctactgatgagcctgtagttccaggaggacactgctaactctgaaaatgacctataaggaaacaaaataccaaaagcacacggacacctacagttca
aataacacgctttcattcgtgcgtcttcaccgacaacttgctatgccttgtcggtcgc