Description :
Non Conding Region
Location :
contig_1:68854- 71549
Sequence
2695 bases(100 bases per row)
GTTGCCGATGCTGTTCTTTCTCGCACTGGCAGAAGCAAACAAGAAAGACCTTGCCCAGTGTGGTCCACGCTACGAATGAATTGACTTCAAATTGAATTGG
TACTTCCACTAAAAAAATGATCAATTCAAATTTGATTCATCAGTGACGGTTCCGAGAACTAGTTCCATACCCAGGAACCGATAGGTAACCGCGGCATAAT
CCGACGCATAATCATGTCGGCAGACCTCCGATCCTCCACGTTGCTGTTTAAATGGCCCGGAAAGTCGGAAAGTGGGCAATTCGCGCTCCACTGGAGGCCA
AGTTGCCCGACATTTGACTTTCCGAGCCAAACAAACAGCAGCCAAAATAATATTTGGGCAGTACCACGATGCACTCATCACCTAGCCCTAATGGATATTC
GCGCGCTCTTTCTTATCGTGCTCTCGCTTCTCCCCATCCGTGAGACCCGAACTAGCGTATTGTAGTTCCAGCTCCAGGTCCTCATATTCACATCGTAGCT
CACGTTTTCCCGATTCGAGCGCGCCATTTAGACGCAGCAGTTCCGATACACGAGCTTGAATTGTCTCCAGCTGGCGCAGTAGGTCTTCATTAAGCGTTTT
CGCTTCACGAAGTTCTGTTTGCAGCCGGGTTTCCTTCTCCTGGGCCCTGACGCCTTTGTCGCCGCCTCAAGCTGACCCATGAGTAAGCGCTCACGAGTTC
CAGCGCGTCTACCCGGCTCTTTAGCCGGCCAACCTCGCTTTGATTGCCACGTTGCTGCTTAAGCTCAAGTAGCGGTAGTTGAGTCTGCTTGTCTTCCAAA
TCTTTCTCCAGTTGCTTTCGGCGCTGCTGTTCGACCAATATCTCGTCTTCCAATGAATCTAAACGCTTCCGGAAAGCCTCCCACTTCGTGTTTCGCGCGG
TCCAGTCACGCTCTTTCACTTGCCCGATCGCATTCTCGAGAATTTGGACTTTATCGCTTGACTTTTCACGAACTGTAGATAGCTCCTGGGCCTTTTCTCC
ATCTCCAGCTCAAGTCGCTGATTTTTCAGGAGTGTTTGTTGTTGCGTCTCCGTTACTAGGTCGTACTGCACAAGGAATTGCTGGTAGGTCGTCTTGATCT
GCATCAACTGATGCTGGAGCTCGCCTACAATTGCGTGATCTTCTGAGGAAGCCATCAAATCACGAAGTCGTTCCTCCTGCTGCTCTAGCTGCCCCACCTC
GTTAATTCTCTCGTACAACAGCGCGTTCTCATTTCGAAGCTCATTGTCATCTCCAGAACGTCCTCTGAGCGGTGGCAACTGCACTAACTCGTCAGAATCG
ACTACAGCCTTTCGATCAGCTACTTCAAGCGTCTTCACGCGCTCCGTTTGCGCCTGTAGCTCGTTCTCAAGTTGATCTATCCGGTCGTGGGGGATATCTG
AATCGCAACCGGTTTCCCCACTTGTATTTCCTGCACCACTTCTTGCACTCTTTTCGGCTTGAAGAACCATGAGACTATGCTGTGTCTTGGTTAATCGTGC
TGGTAGTTCATACATCGCTAAGTACTTGGCATGCATTTCTGCGTAACTTTCACCCAGTGCGTTGTACTTCTTCAGCACGCCAGTCATTGCACGTTGTTGC
TGATCAGCAAATTCACGAAGCACGCTCTTCTCCAGAGTTTTTTCCATGCGGTCAATCATCTCGTCGGCACCCTGCTTCCACGTCTCTAGGTACAAGACTC
GATACTTATGAATCTGTTCCGAGTCGTGCAACTCGCCCAGACTGGATATTGGCTGGGTTCCAGCTCGTGGGTGGGGTTTCCTTACGCAGTGAGTGATCGC
TCCCTAACAGCCATTCATAGCCAAAGAATGATGCACGATTTTATCATTGCTGTTCCAGCATTCCACCGCCGTCTCAACATTGTACATTCATTTAATGAAT
GCATTTGTGTTGGAGAATGCAATCCAACAAGGACCAATGCAATTGTTGCACCATGCATAATTAATTATGCGCTGTGAGGACGCTGAAACCACAGGCTCGA
ATGGCTATACCTGCTCTAAGAGTTCACACTGACCCAAGTTCCGCAATTGAAATGCCCCGCTTCGACGACAGGTTACCATTCGTTCCGGGGTGGACTGGTA
GTCTGTCGACCGCTACATAGTGATTCGCACTCGCTATTGTAATGAAACACGATCATTTACATACCCTAGATTCGCGTTCGAGAAGACTGCAAGGCGGAGA
AAGAAGATGTTTTGAAGCAGACAGCGATCACCAGTACTTTCAGCGGATTTTAGTGTCAAATTCACCAATGCCCGAGGGTACGACAAGTCTGAAATCCAGA
GGCGATACGTGAATGTCGGCTATTGTTTGATGAACTTTCGTGTTCACAAAGTGTAGGAAAGTGTAATGCACTTGCGAGGGGGTGCTGCTCAGTCCATACA
TTGGTAAGGTCTGTTCGTGCAGCTCTCTCAAGTCTAACTGCACGCGTTGTCCTGCAGCCTGCACGCACTTCAACATTGTTCTCATGAACGCAGCATCCGC
AGAGGTGACAAGATGCCCTTCGGGGAATAATGGGTTAAGTGTCAAATTTTACTATCAGATGAAATATAAGTGGGCCAATTATCACCAATTGTTTTTACTT
TCACGAATTTCCCAATTCGAATTTCCGCGAAGAACTTTGCGGAACCACAGCCACTTTTGCCTCGAAACACTCAGCCGCCAAGTTAGAAGCCAAGA