Description :
Non Conding Region
Location :
Scaffold_1:6875- 7790
Sequence
915 bases(100 bases per row)
GCGACCATCCACTTGTCTTTTAAGTCGCTTCTCATAGCCTGTCCATAGTTCTTCGGATCCGCCTCCCGCACGGTATCTACTACGTCGAGGTGTTCCTTTT
CTTCAGCTTTTACAAGAAACTTTCTCACCGCTGCCCTTATCCTGTGTGCATCTCGTGTCCAGCTACTCCTCCATCCTCGTCCTTTGGATCCTTTTACCGA
AACTGATACCGGGCATTTTTCCATCGAACCTTCGTCGTTTCTCTCCTCAGCCAATGTCTCCACGTTTCTGACGTGTTGAGCCACAATTACGATCTTATCC
TTCGGGTTAAAGACTCAATACCCTTTCATCTCGTCACTTTTTTCCGATGATGACCTCTTGTTTGCCGCGTTCACCAAATGACTTATTCTGCGCATCCCAT
GCACGGTGCATGTAGACCAGAATGCCACTATATCCCTCAAGTCTGGACTGCTTTTCGTGAGCATCTTTATTGGCGACTGCCTTTACGGATTAGCTTTGCT
TGGGCTCCGATTAAGAATATATGCTGCATGTTCTGCAGCATCTCCCCAATAACTTAACGGTAGCCCAGAAGCAAAAATCATGCTCCGTACCATATTCATA
ATGGTGCGGTGCATCCTCTCAGCTTTTCCATTACTTGCCTGGTTTCGTGGCTCACTTTTCTGTCGCACAATACCAGTTTCCGTGCAAAAGAGATCCATAG
CGTGATATTCTGCTCCACCGTCCGTTCTCAAAACGTGAATTCGGCAGTTAAACTGCCGCTCGAAGAAAGCCATGAAATGTTTAAACTTCTTTGCTGCAAC
GTCCTTTGTCTTCGCCAAGAACACGCGACAGTAATTCGTTCTGTGGTCGATAAAATCTACCATGTACCGGTTTCCCAATCTGTCGCGGGAAGTCATCGGT
CCCTTCAAATCTGAT