Description :
Non Conding Region
Location :
Scaffold_1:68725- 69311
Sequence
586 bases(100 bases per row)
TTTGTTACCCATTAGACTCCAGCAACCACATGCCTGCCTGCCATATGAATCAGATCGACCACGAAAGGTGTTATATTATCGCGAGCTTTTTCTTCTTTTT
CCAAGTTATCTCCATTTTTTGTTCGTTAACTCTGTTCTGCTGGCCATCGCAAACAAACAGCGCTGACACACAAGCGAACGGTTGCACTTGCTGCTTGTTA
TTCACGCACACGCTCCTGTTTTTTTCTCTCTTCTTGCTTCCTCCTCCTCCGCTGGCGGTGCTTGAGGGGACTTACTGATACAGCTTACTTGTACATGGCC
TGTCCGCTCACTCACTCACTCTCGCTTGTTTTTTCTGTTTGCCACTCGTCTCTTTTTCTCGTCTTCTTTGATACAAAAGCTACCACCAAGTTCCTCTTTT
TTTTCTCTCGTCTCAACCTATCTACAAAACAAGCAAAATTTTCTCTGTCTTTCTCTCCATCGTTGTCGTCGTCTCGGCGCCACGCTTTCTCCTCTTCATT
CTTCAATTTTCCATTCAAACTTCAGTTGACTTATACCGCGTCTCCTCTCTCTCTTCTCCACTATCAAGCAAGCTTGGAGAACTTCT