Description :
Non Conding Region
Location :
Scaffold_1:68712- 68853
Sequence
141 bases(100 bases per row)
ACGATTGTGAAGTGACCTGATGCTGCCCAAAAGGTGCGAAAGGTCGCACTGCCACTTCATCATACAGTCACAGATATCAAGATCGCACATTACCTGGTTG
CTGAATATATTCACGTCAAACATGAGTCTTGAGTACCATGC