Description :
Non Conding Region
Location :
Scaffold_1:68650- 68993
Sequence
343 bases(100 bases per row)
AGAAAACAGAATGTTCAAGTTTGAACTTCCAAACTTGAATAATCGGTTATCGCTAAAGCGAAAATTCTGGGTAATCCAGGAGCCAAGAGGATTGGCCAAC
GGAGTCAAGGCGTCCGCAAAGTGCGGACATTAAACACAAGATACAACTGTAAGTTCACAAGGTCCGTGTATTCTTCAAAATCCAATTTTCACACGAGTCC
AATCGTCTCTTCCCCACTATACTTGTCGAAAAGACGGCTCACCGTGCACGCCGCGAAACGTATGGCGCCCGCTATACGAGCCAAATGTTGCACGGCGGGC
GCGAAAAAACACAACACAGATTGATTGGGACGTCAAGGCAAGA