Description :
Non Conding Region
Location :
Scaffold_1:68648- 70041
Sequence
1393 bases(100 bases per row)
TCGATGTTGTAGCCGTAGAGGTCATCGTCGNNNNNNNNNNNNNNNNNNNNNNGTGGCGCGCGCACGCGATGATGAGGCAGAAGAGCACGAACACGGAGCC
GCCCATGCAGCCGAGGATGATGTTGATCCGCGTGCCGTCGTCCATCTCGCGCTGCTGCGTCGTGTACGGTAGGGATATAGCGGGAGCTGAATGCGGAATA
GCGCCCAATAATGGGGGGAGATCTCAGGGCGGGCACAGCGGATGGATGGATGGATACGGGGCTGATATGGAGACGCGCTGCTCTCTTCTTCGTCTTGTAT
TGGAAATAATAGGAGGCGGCGGGTTCAAGTGCGCTCGTCCGTTGGGTTACAGCCGCATGCAACAAACAGGACCTCAAAAGAAAACCTGTGATGTCGTCAC
CTGGTAAAATGGGTCAGTGAATTAAAGAGGTTCTGAAACAAATAATTTCTGACTTGTAGAGATCAATGTAATAGATCTTTTTGTGGTTATAATTGATGTA
AAGAGGGTGACGAGTGCAAAGAAGGAAGGAAGTTGCACACCAACACGACATCTGTCGTGTTGGCGAGACTGAGACTGACTTTGGCAACGTGTGTACGAGC
GGACGCCATTTTAACCAATCGCACGTGAGCATTTTGTACAAAGCTGGCCAATTTTTGGAAGATACCAGTTGCCTCATATAGCCTACGAGCAGTCTATTCT
ATCAGTTCGACAAATAATCCTAACGTAATACAGCATTTGCCCTACAATCTTCTGCAGAATACGAGATTTACCCTGTTATCATTATACCCTATCATTAAAA
GAACCCCAACGCTACTGTTCTTTTGGGGTGGTACAGCGTGCCAGTTCTTGGCAAAGAGAACTACTCAGTTTAGTCGAAGCGGTCGCATTGTATTCTCAGC
TCTTCTCTTGTCTTTCTTTCTGCCTGTCTTCCGTGTGAGCACGTTCATTGTGTGTGTCTGATAGGGTGGGTGCCTGTGCTCAGCTATATACACTTCCGGC
GGTAATGCGCTGTTGCGCTCATGAGTAACTGCGTCCCTCTCTCTCTCTATACCGCCCGTCGTTCGTCAGACTAAAGCGTCTGGAGTGTCGCTTCCAGCTG
CATGACGTCGCTCTCAAGAGCGTCGGTGACGCTGGGGATGACGGCTCGCAAAGAGACCCACCAGCTGGGAAGACACAACAGAGAGAGAGAGTGAAGGGCG
TATGCATGCATGGATGCGCGCTTATGTAATGCTGTCCATTGACTGTTCCCTCTGGTTGTTTGTTTCCATCAGGTACCTCCTCCTTCAAATATTTGTGTCA
GGGGTAGCTGTTCGGTCACATTCACATAACAACCAGGTGGTGGGCGATCAAGAGAAGTGCTCTGCTGCAGCGTGCGGCTTTCCTGTACGACGA