Description :
Non Conding Region
Location :
Scaffold_1:68549- 69342
Sequence
793 bases(100 bases per row)
CAAACGGATGGGTATTACCGGGAGGCTGCGAGAATGTTCACTCCACGACAGGCGTCAATGCCGCCTCTCGAGCAGGAGCAGTAACGCTGGCGAATCAACC
AGCTATCGCCTAGCAAGCAATCCGAGAACATTAGACGACTCGAAGTCTTGTCCTACGTTCCTTGTCTACAGAATGCTGAATGTCGATCTCGATCCAGGAA
ATGAGGTAATCTGAAGCAGGACGATCTTGGACGCGTTCTGCTCGCGATCCACAGTCATACCAAAACAGCCATCGTGTCGACAATGGAGGTGTGCCGTAAA
CCTTGATGCGACGAACAACGCCGTCCATTGGACTGCTACATCAGGCAGTTGCTCATTCGAACCCCAGCAATCCATCGCACAGAAACGCACTTGTTATACG
CGCTTATCAGCTGACCAATCGGCGGCTGTGTTTCTGTGTTGAAGTGAGCCGTTTAGTCCAATCGCCGCCGCGCGAACACCCTACAACCCATTTTACTGGC
TGAAACGTGGCGTCACCCACCGGGAAAACTCGGAACCGAAGATCGCGAGCGTAATCGAAGTCGAACAGCTCACTCTCATTCGACTCACTCAGAACCGTCA
CAACCAAAAATCAGACCGAGTCCCAGAGCGAGAAAGACAAGCGCACCCGAGCTCGATGGTTGATACCAAGGCGCGACGCTCGCCAACGGAGCGCTCGCCG
CTGCTGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGTCGAGCCATGAAGACCTCCCGGTGTGGTTCCAGT