Description :
Non Conding Region
Location :
Scaffold_1:68270- 68321
Sequence
51 bases(100 bases per row)
GAGTGTACCATGGTAGATGAGTGCGCTCGCTGGTATATTTTCAGGAATGCT