Description :
Non Conding Region
Location :
Scaffold_1:6801- 7097
Sequence
296 bases(100 bases per row)
CTGGTCAGGGCTTTCAGTTCGAAATGATACAACTACAGTAGTACACCATTTTCTAGTTAGTACTTTCAGCTTTTATTCAGTATATTTCCCCTGTTATCCT
TGTTTTTCACGAAATCACCATAAATTATTTACATATATTTACGAAAACTGAATTCACACGATGGTAGAAAGTAGTACGGTTTGGTGAAAACACGAAACAA
AGTTGAGGGGAATAAGATGAAATACTACTAAATAATATTACTATTACTTCGACGTATTAATAGTTCTATTTTGATTAATAGGTGCAAGCAATGCTG