Description :
Non Conding Region
Location :
Scaffold_1:67947- 68680
Sequence
733 bases(100 bases per row)
tgtgtaggttgagctggagggaagctggcttcttggggtccagggaaatgttggagtgaaaCACACACAACTCATTAGCCTCCTGGAGCAATTTTAAACC
AATCAAATGCACACAAAGCTGTTACAAATTCAGGCTACCTGTTCCGCAACAAAAGCATTGACGGGAACGCGCCctgtctcgtgaatagaaagtagtggcc
gtcaaaatcgcattgatggaaatagtagggcattttggttacgctgacacaagttctgctagagtggtgttactagagttggagaatgCGAATTGGGTGT
AAAAGGCGGGAGTGACGTGCTAAAAACGCCTCACTCCCGCCATTTCCAAGTGCCTCTGGGGCCAACCAAAATAACCTAATATAATGCATAATACATTCGA
TATTATTTTGTAAAGTTTCAttgaatttgagcgctcacgctttgaatttcagtgttgactttgttaataacgcggtgcaatggtgtagCAAAATAAACCG
CGCCAACGTCAGTCTTATTACCCACCGGAGTGACATTTTCGCAAGTATTTTGCTGGTTTGGCGCAGCATGCCGTGCTCATCAAACGCTGACGCACGGAGA
AGcggaacggaaacgcatgtgactgttgatctgttgataatactcttcatcctggcacagttgctgtgcctgcgcacgggTTACTCctggcaagtgtttc
gagttcttcaaatgaacgagaatcactccacca