Description :
Non Conding Region
Location :
Scaffold_1:67933- 68254
Sequence
321 bases(100 bases per row)
TGGATAGCCACCGAGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCGGCG
ACCGTGCCGCGCAGCGCGTTCGCGTGCGGGTTCTTGGTCAGGAACGTGTTGTTGCGCAGCTTCGAGAGGAATGAGTCGGATTTCTGAAGTGTGGGCTGCG
TCGTGCGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGCCGCGCTGCTT
CTGGGTCAACTGCATCTGGTT