Description :
Non Conding Region
Location :
Scaffold_1:67891- 67926
Sequence
35 bases(100 bases per row)
CCCGTAGTTGAATCTTCATCAATGCACAAAATTAT