Description :
Non Conding Region
Location :
Scaffold_1:67709- 68590
Sequence
881 bases(100 bases per row)
GCCAGTTTCGTCTCCCACCAACATTCCAATCCATGGGTTACATTCGCGCAACATTATAGATATCGCTAACCAACTACAAACGCCCGCCTCATCACAAGCG
ACGAAATACTTCAGTACCGGTAGTCTCTCCCTCTAACCATCTCCTACACACAAGCCTCATCATAGGAGCGGCGCTCCAGGCAGGGGCGCTCCCGGAGCGT
CGGATGATCCATCGCCGCCGTGGGTACCCCGTGCCGTTGGCACAGCTCCCTTGGCGACTGCCATGGCGTCGACTCTTGCGGTACGTTTTCAACACGTCGC
AACTCGCTGTCTTTGTAACTAGGTAATACCGGTGACCATGAAATATTGGGATAAGCTTGACGTTGTCAAACTTGGATGCGTGACAATGCTATAAATCATG
TTCTTACGGGCATGAAAGTACCATCAGCTTTGCACAGCCAGCAAACTCGGCTCGAAACGCAGTCGTTTTTtGCTGGAATCGTGTGAAGAGTTCCAGCTTG
GATGTAGAAGTATGTTTGGgCCATTAaTAGTTGGgATCTCcACCTACTTCTGCATGCCAAGTTTGCTCTCCTTTTTATCGTTCTGGACTACGTGTACTTG
AAGTTTTTATGCTATAGTTTTGATCATCGTGATTAGTCTGTGCCACAAGTGAGGGGTCTTGTTGAGTCAGAGGCTTGAAGCCTCATCATTGACACTTCCA
GACTTCATAACTGTTTTGATTTACTACTTAAATAGAGTATTTATGTATCCAACAGCATCAAATTAAGAGCTTTATATTCTAATACCTTGTCCATAAAGGT
CATTTCATGAATGGATTGATAAATGGTGTTCTGAACTGTTGCATTGGGTCCCATTTCCCAATTACCACGACGCCGACAGCA