Description :
Non Conding Region
Location :
scaffold_1:67603- 71795
Sequence
4192 bases(100 bases per row)
TGTTGCAGTATAAAAGTTGCCGTTGCTTGTCGTTTGGCAGAGAGCTGGAAAATCATTTATCTCACTTGGAAGAACATGCTTGCAATACACCTATTGACGC
CGTGTAAAGTGTACAAACAACATTAATAATAGAaacttttgatcaaatctATATTGGCGCTCCATGACAAAGTCTCAGTCCAAAAGTCGCATCTTCCAAC
GCAGCATTCTCGACATTGATACTTCCTACTCGATTGCGAATGTATTAAGAAACGAGGAATTAAGTCTTGCTGCAATAGGTGAGAGCATCTGATATGATGC
TTTTGCTTGCAACTAGAAAAGTATTCACGAAAGTATAAATAAACAATTTGTCCTAATAGAATATTTGATGGTTTGGAGATATTTTTGTTATTGTTTGTCC
AGAATTTTCTAAACGAACTTAAACTCTTTTATCACATTTACAATTTGGTCATTAGCAAAATTTCCGCTCTCACCTGAAAACTTACGATAGGCAGTTCACC
GAGAAGAAGGCAATAACTACGCCCCGCAGGAGTCACCATCTCCGTGACTTACCTTCAGTGGAGAGCATTGCAACTCCTACCGTGGAGTTCACGACTCATC
ATTAAATGTCTGGCCCTAGCTGAAGTGCCCAGGTTGCTCGTATGCAAGCGCTAGATCGCGCCAACTTGTGCCAGTTTCATCTCTTTGACTTACTGAGGGA
GGCTTTTACCCACCTTGGCATATCGTGAGCAAGACGAGCGCCTAAAATTGTTTTACAAGTCCATCCTCACCACCGGTCATCTCTCCTCATGACTACTGCC
AGCGCTTAGAGCAGCCGTGATCAGGAAAAAACCTTCGTCTCATGAGACTGAAAAGTGTCAAGAATGCTGACTAAATTCATACTCAATTTACGCTCGAAAA
AAAACTAATAGTCTTACCCGATTTACCCGTCTCTGAAAGTACAAGCCAGATTTAGTGAAGCGTCCAAACAGTGTAAATTGATCCTTCACTTTGCGAAGTA
CAAACCAACAACACGGACTTCGAGATGAAATTTCATCACGTCTTATTCTTGCAACTAAAGTTTTGCTTAGCTCTCTAAAACCGAAGATACACACACGGAA
CACGTATGAAGCACACGACAACATCGACATTTACTCCCTTCTTGAACGCACTGTGACGGTGACCTTGGCAATTTCCCAATGGAGATTGGCGTACATGGCG
CACCAGGTTTAATCGGCAATGGCGTCAGGTAAATTTTGCCAAAGTGAAATCTCAACTGCTCGCAGACACTTGTTGCGCACAGCGGAGTATGAGTAGAAAG
TAAGCTACAAGATCTGTCAGCTTACTCAATATGACAACGTTGTTCGTTGTTTAAAAACAACATGTAACAATTATTTCGTGCTCCAAAACGATCAAGGTGA
CAAGGTGCTTTGAAGCCGCTTAACTATGCAAGTTGCCTGTGTGCGATGCAATAAAAACTGTGATGAGACATCAGCGCACCTCAACACCCATCCCCAACCT
GCACGTCGTCAAATCCGGTTTTCTGATCTGTCAGCGACATGCGCTGCGTCGGCAAAGCATTTGTAACGAAGTCGGTGAATTTATTCTATGTTAGTACATA
CACCAGTTAAATGGTTCTGCACATACTAAGCGTTTAATGCTCCTTGCGCGACTTTTGATCAGTAGTCATCGGGCCATTGGCCTTAAACTATTTTGAAACG
AAAGGTAACGTAGCCAACTGACATTTTGTGCCACCAGAGCAAGTGCTATGCATTTAATCTAGCAGAGAAAATAGCGGTGATGGTGTGTCGCTTGCATTTA
AATACCATTGCCTCCTCTGATGACAGCAAAACTCTCGGTATTGAACGACGCATAAGCTTGTGACCGCTTTTTGCGCCACCAtaagctttgatactcgatc
GATCACTTGCTCTCGTGCAGATTTGCAATTTTGGTGATTGCAGAAGTAAATTATTGTATGTATTCCCGGTAACTTGCCCAAGTGGTCTTGGGGGTGGATT
TAAGATCCGCTAGACATGCCAGTCTGTGTAGGTTTGAATCCCACAGATACGATACCAACGCAGCGTTGTCTTCGATGTAATGGTGTCATCAGAAGTGGTA
TACAATTATGAATATATGCTCCTTCGAGATAGCACAGAACACGTATTTCAGCCCTCTGATTCATTCACGTAGCAGATTCAGGTATATTGATAGTTCGCAG
AATGCGCGACGTTTTGGCTTGGTAGCATTGGCGACGTATAGCAGAAAAGCAATCCATTTCGAGTAGCAGCGAACATTTGACACAAGGTCTTAACTTGTTG
TGTCGGGGTTGAGACAGCATTTTCACTATTTGGCTCTATGTTTGTGAACTTGAAGGCGGTCTGGCTTGCTCCAAACATTCGAAATAATTTGAGCTGCCAT
AAGAACTGGTTATGATATCTGGGGTAGACCCTGGGTCTTCAAGCGATGTGACGCGTGGAGACAGGACAGACTGCAACGAAGGGGcaatttttaaaaagcg
TAGATCAGCATTCTAGGTATCCATGATAAAATGAGGAGGTAACAAAAGCGGCAGGTGATGATAAAATGAGGAGTTATCAAAAGCGGCAGGTGAAGAAGAC
AAGTTCTCccaaaaatcaatttatgTACAGTGCTGGCAGTGATAATAAGACCACCGTCTCTTTTGAATCCTGTGCGCAAATTCTCGCTTTTTAGCCCATT
ATTCACCAATGGATCAAGACGCATCAACTGATGCATCCCAATTGAACATCCAATGCGCAGAAACTGACATACCATCAAATCACACAACTTCCTACCGGCA
CTTAAAAGATCAGATTCGATAAATTGGTAATATGATATCGCAATACAATGGACTACGTTGGTAATACATCTGGGAATATCCAACACAAATTATCAATCGA
ATTAAGATGTAGAGACCTGATGGGCCAGCACTTCGCAAAAATTTGCTACACAACGACGCCACTGAGGTATGGGAAATGTGTATGGATGCATTATATATTC
CAGCGGCATGGTTTGCAGCAATACATGAGATTGAAAGTTTCTGAAAAGTCGTTGTGTGCTCGGCGCTGTTTTTACGCTCCTTTCAAATCGCAAGTTTGAC
TTTTCCGCAAGAAAAACGTTCAAACATCGCTGACTCGCCGCTGTTTTGCTGTTGCGAATATTTCGCAGAATTGGAAGCCAATAGGCTTAACCTTGTCTCA
CAAAAAGCGCATCTAGCGTCATTGTGCATGCCGTGTCTGTTGTTGTTGAGCCCAGATAAGGCACGCCAATTTGTGAAATTGCTATGTGCTGGCATCTTTA
TGCGCTTTATAAACTTTAGCGTGAGACATGCAGCCAGGAGAAGGCGAACACGTTGAACACCTATCGGTAAGGTCAGCTCATTTGCCAGCTGAGTATAGCT
AAGCTTGCCTGTACGCGTATCTCTTAAAAGACATTGAGACCCGTTCGGCGTCAACTTGAGCTGCCTTTTCGTGCTTGTGATGGTCCCAAATTTCGCTGAG
CACTGGAAGTAGTTGTGCACGGTGGTCTAAGACCGTCCAAGCGTCGTCGTGATGACCATCTTCGACTCTCTGTCGGCCGAAAGTTACGAAATCTTTGCAC
TCATAGGCAGTGAGCTTGGGAACTCTGCATTGTAACATCCTGACAAAATAGATCCACAAGATGCTTGAGCTTCGAGAAGCTTGAATTCAGCATTCGTGGA
AAGTCTCCATAAGAAAGAACCGACTTGCGCAACCCACTTCGAGAGACAGAGAATCGTCGATCTCGTCACCATTACAGATCCCCAAGTAGGGagcagcatt
ctgtatcacacagagtatttgtgacttcaaacagaagatgtcacgtatgcatttggaaaCACCACACTGTGATCTTCTCTATaaattcccacaatgcata
cagaaggtacagTATCTTTTGATGGATGTACcgtcatgtaatggctacgTAGAGCCCATTACATTTGAGTGGTAGGAAATCTGAGGTTCTCGTTGGCAAA
AATGTTAAAAAGTGGTTTTTATTATTACTTGCAGCAGTAGTCGGTTAATTGCGAATTCCGTATTCATCACTATCCCTATGACCACAGCGGAGATTTTCGG
TTCATACACATTTGTTTATCTCATGCGAGCTGTTACAATACGATTTACAATATCTCGACTAGGAATTTACGCAATATGCGCTCTTGGAAGCT